, 2002), rabbit anti-Caspr5 (antibody was made by immunizing rabbits with a GST-fusion protein containing the intracellular domain of human Caspr5), mouse anti-myc

(clone 9E10; Roche), rabbit anti-VAMP-1 (SYSY), and mouse anti-PSD-95 (Thermo Scientific). To isolate putative GABApre neurons, YFPON cells from p0 Ptf1a::Cre; Rosa26.lsl.YFP mice were purified Selleckchem Carfilzomib using fluorescence-activated cell sorting (FACS). Briefly, spinal cords were dissociated using Papain dissociation kit (Worthington) and sorted based on YFP fluorescence. RNA was then isolated using the Absolutely RNA Nanoprep Kit (Agilent) and cDNA was generated from these cells using WT-Pico Ovation Amplification Kit (NuGEN). RT-PCR was performed on cDNA generated from purified RNA using the following primers: ChAT (forward primer (FP): TCAGGGCAGCCTCTCTGTAT, reverse primer (RP): ATGTTGTCCACCCGACCTTC), CHL1 (FP: AGGACAGCGAAACTCTGGAA, RP: TCGTGTTCTGCATTTTGAGC), GAD2 (FP: AAAATCTCTTGGGCCCTTTC, RP: CCGGAGTCTCCATAGAGCAG), L1 (FP: CAAAGTCCAGGCAGTGAACA, check details RP:

CTGTACTCGCCGAAGGTCTC), NF (FP: ACCTGGAGACCATCAACCTG, RP: TCAGGCAAGGGAATAGATGG), NrCAM (FP: AATCCAGTGTGAGGCCAAAG, RP: GAAAGCACGAGGTTTTGAGG). S.A., J.N.B., J.D.C., S.B.-M., V.B., and J.A.K. performed experiments. S.A., J.N.B., J.D.C., E.P., T.M.J., and J.A.K. designed the study and interpreted results. E.P., S.B.-M., Y.S., and K.W. provided reagents. S.A., J.N.B., J.D.C., T.M.J., and J.A.K. wrote the paper. We thank J. Sanes for generously providing antibodies, T. Sakurai for experimental help and helpful discussions, and N. Balaskas, A. Fink, S. Poliak, only and S.-H. Shi for comments on the manuscript. We are grateful to K. Kridsada for technical assistance, D. Ng and J. Zhang for critical assistance with in situ hybridization, J. Bikoff for providing Ptf1a-derived cDNA, I. Horresh for checking antibodies to Caspr5, A. Todd

for assistance with synaptic staining, D. Montag for CHL1 mutant tissue, and T. Cutforth for providing Kirrel-3 mutant mice. We thank Y. Zhang and J. Salzer for breeding Caspr mutant mice, S. Markx and J. Gogos for breeding Caspr2 mutant mice, T. Karayannis, E. Au, and G. Fishell for breeding Caspr4 mutant mice, D. Felsenfeld for breeding L1 mutant mice, and T. Sakurai and C. Mason for breeding NrCAM mutant mice. This work was supported by a National Institutes of Health (NIH) predoctoral training grant (527975) and a Columbia University Neuroscience Fellowship (J.N.B.), a Medical Scientist Training Program (MSTP) grant from the National Institute of General Medical Sciences of the NIH under award number T32GM007739 to the Weill Cornell/Rockefeller/Sloan-Kettering Tri-Institutional MD-PhD Program (J.D.C.), a Grant-in-Aid for Scientific Research (B) (#18300120) from the Japan Society for the Promotion of Science (Y.S. and K.W.), NIH grant NS50220 and the Israel Science Foundation (E.P.), HHMI, Project ALS, The Wellcome Trust, EU Framework Program 7, and NIH RO1 NS33245 (T.M.J.