Figure 2 Diagnostic size difference for the VNTR-141 locus of Wolbachia . Lane 1: wCer1 and wCer2 doubly infected R. cerasi from Austria (the two arrows indicate the two faint bands for this website wCer1 and wCer2); 2-4: wWil infected D. willistoni from populations collected recently in Panama (Pan98), Mexico (Apa), and Equador (JS); lane

5-6: wAu infected D. simulans strain Coffs Harbor and Yaunde 6; lane 7: uninfected (tetracycline treated) controls = D. melanogaster yw67c23T; lane 8: wTei infected D. teissieri GN53; lane 9: wMel infected D. melanogaster yw67c23; lane 10: wSpt infected D. septentriosaltans; lane 11: wCer1 singly infected R. cerasi from Hungary; lane 12: uninfected (tetracycline treated) control = D. melanogaster line yw67c23T; lane 13: wMel infected D. melanogaster yw67c23; lane 14: wMelCS infected D. melanogaster Canton S. In contrast to VNTR-141, the basic period of VNTR-105 is 105bp long containing two 23bp hairpins with 9bp palindromic stem structures and one internal short repeat of 10bp (Figure 3). VNTR-105 of wMel contains four complete 105bp periods, and two with internal deletions of 25bp

each. wMelCS and wMelPop lack one of the complete 105bp periods, i.e. contain three complete 105bp copies and two with internal deletions of 32bp (Figure 3). The tested supergroup A Selleckchem 17DMAG strains display different alleles in the VNTR-105 locus Pitavastatin cell line with amplicon sizes ranging from 3×0.5 copies (wCer1,

amplicon size using the locus specific primers 998bp), 2.5 copies (wWil 1065bp, wAu 1065bp), 3+2×0.5 copies (wMelCS and wMelPop 1241bp), 4+2×0.5 copies (wMel 1347bp), 3+4×0.5 copies (wSpt 1408bp) and 5+2×0.5 copies (wSan, 1476bp; wYak and wTei had similar amplicon sizes to wSan but were not sequenced). wCer2 had a large amplicon for this VNTR locus and difficulties were experienced with accurately sequencing these large loci because of restrictions with read lengths, as well as problems in detecting an accurate overlap between forward and reverse sequences. VNTR-105 amplicon size NADPH-cytochrome-c2 reductase differences can be easily resolved on agarose gels (data not shown). In comparison to VNTR-141, the structure of the VNTR-105 locus is less conserved within and between strains because of internal deletions, yet the period sequences are almost identical (i.e. 98%) within wMel and between other strains. For this reason a phylogenetic analysis of period sequence data is not appropriate, whereas the analysis of diagnostic characters such as copy numbers are more informative (Figure 3). Figure 3 Schematic presentation of the VNTR-105 locus in seven w Mel-like Wolbachia strains of Drosophila . The complete 105bp period is shown as black arrows; the two 23bp hairpins A and B as full and empty lariats, respectively; the 15bp inverted repeat as grey boxes; and deleted sections in grey.

Eukaryotic Cell 2005, 4:1562–1573.PubMedCrossRef 45. Yeater KM, Chandra J, Cheng G, Mukherjee PK, Zhao X, Rodriguez-Zas SL, Kwast KE, Ghannoum MA, Hoyer LL: Temporal analysis of Candida albicans gene expression Selonsertib cell line during biofilm development. Microbiology 2007, 153:2373–2385.PubMedCrossRef 46. Nett JE, Lepak AJ, Marchillo K, Andes DR: Time course global gene expression analysis of an in vivo Candida biofilm. The 2009, 200:307–313. 47. Green CB, Zhao X, Yeater KM, Hoyer LL: Construction and real-time RT-PCR validation of Candida albicans P ALS -GFP reporter strains and their use in flow cytometry analysis of ALS gene expression in budding and filamenting

cells. Microbiology learn more 2005, 151:1051–1060.PubMedCrossRef 48. Skrzypek MS, Arnaud MB, Costanzo MC, Inglis DO, Shah P, Binkley G, Miyasato SR, Sherlock G: New tools at the Candida Genome Database: biochemical pathways and full-text literature search. Nucleic Acids Research 2010, 38:D428–432.PubMedCrossRef 49. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ: Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 1997, 25:3389–3402.PubMedCrossRef

Authors’ contributions HN participated in the design of the study, performed the experimental procedures, carried out the data analysis, and drafted the manuscript. SK and MR helped to perform the experimental procedures. PVD and DD helped in the design of the study and in the draft of the manuscript. HJN participated in JAK inhibitor the coordination of the study and helped to draft the manuscript. TC conceived the study and helped to draft the manuscript. All authors read and approved the final manuscript.”
“Background Haemophilus

influenzae is a fastidious Gram-negative bacterium that is an important cause of human infections including otitis media, meningitis, and pneumonia [1]. H. influenzae is unable to synthesise protoporphyrin IX (PPIX), the next immediate precursor of heme, since it lacks all enzymes in the biosynthetic pathway for the porphyrin ring [2, 3]. However, most H. influenzae strains express a ferrochelatase which mediates insertion of iron into PPIX to form heme [2, 4, 5]. Thus, H. influenzae has an absolute aerobic growth requirement for an exogenous heme source or PPIX in the presence of an iron source. Since the only known niche for H. influenzae is humans, the organism must adapt its mechanisms of porphyrin and iron acquisition accordingly [6]. Heme is generally intracellular, in the form of hemoglobin or heme containing enzymes, and unavailable to invading microorganisms [7, 8]. Extracellular hemoglobin, derived from lysed erythrocytes, is bound by the serum protein haptoglobin, and the hemoglobin-haptoglobin complex is rapidly cleared by the reticuloendothelial cells of the liver, bone marrow or spleen [9, 10].

6% of response rate) and acceptable GS-9973 toxicity [18]; another our experience testing the sequential administration of docetaxel for 4 cycles followed by 4 cycles of EPI/VNB as first-line treatment for advanced disease, confirmed activity and tolerability of the regimen [19]. Incapsulating drugs in liposomes determine improvement of solubility and stability of the drug, and prevent a rapid degradation; moreover, specific toxicities

are potentially lowered and the efficacy increased, achieving a higher therapeutic index [20]. Liposomal anthracyclines exhibit efficacies comparable with those of conventional anthracyclines, but with better safety profiles [21–24]. In particular, data from retrospective analyses showed that liposomal anthracyclines significant reduced the risk of cardiotoxicity

compared with conventional anthracyclines MK0683 clinical trial [25]. Phase III trials comparing pegylated liposomal find more doxorubicin (PLD) with conventional anthracyclines confirmed similar efficacy and lower toxicity than doxorubicin [24, 26], and results of several studies have shown that PLD is effective in combination with other drugs including taxanes, cyclophosphamide, gemcitabine [27]. As cardiotoxicity concerns, in a retrospective analysis a low incidence of cardiac side effects were reported, even at cumulative doses higher than 500 mg/m2 [28]. The combination of PLD with VNB was investigated in anthracycline pretreated patients, with promising results and manageable toxicity [29, 30], but at the time we design the present study no information about its first-line use in comparison with a conventional anthracycline-containing Elongation factor 2 kinase regimen were available, so we carried out a prospective multicenter phase II randomized trial of EPI/VNB versus PLD/VNB as first-line treatment for advanced disease in patients not previously treated with adjuvant anthracyclines. Patients and Methods Patient selection Patients with histologically proven advanced breast cancer not previously treated with adjuvant anthracyclines were enrolled. Eligibility criteria included a life expectancy > 3 months, 18 to 75 years of age, WHO performance status ≤

3, measurable/assessable disease, adequate bone marrow (absolute neutrophil count ≥1,500, platelet count ≥ 100,000, haemoglobin ≥ 11 g/dL), renal and liver function (total bilirubin and creatinine <1.25 times the upper normal limits), and a normal cardiac function (left ventricular ejection fraction LVEF ≥ 50% by echocardiography). Patients were excluded from the study if they had active cardiac diseases or significant arrhythmias, pre-existent neuropathy, or had received prior chemotherapy treatment for advanced disease, prior exposure to anthracyclines and or vinorelbine, or if they had prior or concomitant malignant disease, except appropriately treated basal cell carcinoma of the skin or in situ carcinoma of the cervix.

J Allergy Clin Immunol 92(3):387–396CrossRef Bernstein DI, Cartier A, Cote J, Malo JL, Boulet LP, Wanner M, Milot J, L’Archeveque J, Trudeau

C, Lummus Z (2002) Diisocyanate antigen-stimulated monocyte chemoattractant protein-1 synthesis has greater test efficiency than specific antibodies for identification of diisocyanate asthma. Am J Respir Crit Care Med 166(4):445–450CrossRef Brandli O, Schindler C, Kunzli N, Keller R, Perruchoud AP (1996) Lung function in healthy never smoking adults: find more reference values and lower limits of normal of a Swiss population. Thorax 51(3):277–283CrossRef Brandli O, Schindler C, Leuenberger PH, Baur X, Degens P, Kunzli N, Keller R, Perruchoud AP (2000) Re-estimated equations for 5th percentiles of lung function SYN-117 datasheet variables. Thorax 55(2):173–174CrossRef Budnik LT, Nowak D, Merget R, Lemiere C, Baur X (2011) Elimination kinetics of diisocyanates after specific inhalative challenges in humans: mass spectrometry analysis, as a basis for biomonitoring strategies. J Occup Med find protocol Toxicol 6(1):9–18CrossRef Campo P, Wisnewski AV, Lummus Z, Cartier A, Malo JL, Boulet LP, Bernstein DI (2007) Diisocyanate conjugate and immunoassay characteristics influence detection of specific antibodies in HDI-exposed workers. Clin Exp Allergy 37(7):1095–1102CrossRef Curwick CC, Bonauto DK, Adams DA (2006) Use of objective testing in the diagnosis of work-related asthma by physician specialty.

Ann Allergy Asthma Immunol 97(4):546–550 Hendrick DJ (2002) Diagnostic tests for occupational asthma. Am J Respir Crit Care Med 166(4):436–437CrossRef Hur GY, Koh DH, Choi GS, Park HJ, Choi SJ, Ye YM, Kim KS, Park HS (2008) Clinical and immunologic findings of methylene diphenyl diisocyanate-induced occupational asthma in a car upholstery factory. Clin Exp Allergy 38(4):586–593CrossRef Jayet PY, Schindler C, Kunzli N, Zellweger JP, Brandli O, Perruchoud AP, Keller R, Schwartz J, Ackermann-Liebrich U, Leuenberger P (2005) Reference ADP ribosylation factor values for methacholine reactivity (SAPALDIA study). Respir Res 6:131CrossRef Jones MG, Floyd A, Nouri-Aria KT, Jacobson MR, Durham SR, Taylor AN, Cullinan P

(2006) Is occupational asthma to diisocyanates a non-IgE-mediated disease? J Allergy Clin Immunol 117(3):663–669CrossRef Kumar A, Dongari N, Sabbioni G (2009) New isocyanate-specific albumin adducts of 4,4′-methylenediphenyl diisocyanate (MDI) in rats. Chem Res Toxicol 22(12):1975–1983CrossRef Lushniak BD, Reh CM, Bernstein DI, Gallagher JS (1998) Indirect assessment of 4,4′-diphenylmethane diisocyanate (MDI) exposure by evaluation of specific humoral immune responses to MDI conjugated to human serum albumin. Am J Ind Med 33(5):471–477CrossRef Maestrelli P, Boschetto P, Fabbri LM, Mapp CE (2009) Mechanisms of occupational asthma. J Allergy Clin Immunol 123(3):531–542CrossRef Malo JL, Chan-Yeung M (2009) Agents causing occupational asthma.

Lepiota s. l. Saronno, Giovanna Biella Chiu WF (1948) The Amanitaceae of Yunnan. Sci. Rept. Natl. Tsing Hua Univ. Ser. B., Biol. and Psychol. Sci 3(3):165–178 Ding ZQ, Huang SZ (2003) Characteristics and high-yield culture technique of Macrolepiota procea. Edible Fungi 4:33, in Chinese Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small quantities JNK inhibitor of fresh leaf material. Phytochem Bull 19:11–15 Felsenstein J (1985) Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783–791CrossRef Gardes M, Bruns TD (1993) ITS primers with enhanced

specificity for basidiomycetes—application to the identification of mycorrhizae and rusts. Mol Ecol 2:113–118CrossRefPubMed Ge ZW, Yang ZL (2006) The genus Chlorophyllum (Basidiomycetes) in China. Mycotaxon 96:181–191 Grgurinovic CA (1997) Larger fungi of South Australia. Botanic Gardens of Adelaide and State Herbarium and Flora and Fauna of South Australia Handbooks Committee, Adelaide Hongo T (1970) Notulae mycologicae 9. Memoirs of the Shiga University. Nat Sci 20:49–54 Johnson J (1999) Phylogenetic relationships within Lepiota sensu lato based on morphological and molecular data. Mycologia 91:443–458CrossRef Kirk PM, Cannon PF, Minter DW, Stalpers JA (2008) Dictionary of the fungi, 10th edn. CABI, Wallingford

Kornerup A, Wanscher JH (1978) Methuen handbook of color, 3rd edn. Eyre Methuen Ltd., London Maddison DR, Maddison WP (2000) MacClade 4: analysis of phylogeny and character evolution. Sinauer Associates, Sunderland Manjula B (1983) A revised list of the agaricoid and Milciclib mw boletoid basidiomycetes from India and Nepal. Proc Indian Acad Sci (Plant Sciences) 92(2):81–213 Mao XL (1995) Macrofungal flora of the Mt. Namjagbarwa Region. In: Li BS, Mao XL, Wang ZW (eds) Biota of the Mt. Namjagbarwa Region. Science, Beijing, p 118, in Chinese Mao XL (2000) The macrofungi in China. Henan RGFP966 mouse Science and Technology, Zhengzhou, p 719, Dapagliflozin in Chinese Mao XL (2009)

The macromycetes of China. Science, Beijing, p 816, in Chinese Pegler DN (1977) A preliminary Agaric Flora of East Africa. Kew Bulletin Additional Series 6: 1–615. London, HMSO Pegler DN (1986) Agaric Flora of Sri Lanka. Kew Bulletin Additional Series 12:1–519 Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572–1574CrossRefPubMed Shao LP, Xiang CT (1981) (‘1980’) The study on the Macrolepiota spp. in China. Journal of Northeastern Forestry Institute 4:35–38 Singer R (1948) (‘1946’) New and interesting Species of Basidiomycetes. Papers Michigan Academy of Science, Arts and Letters 32:103–150 Singer R (1959) Dos generos de hongos nuevos para Argentina. Bol Soc Argent Bot 8:9–13 Singer R (1986) The Agaricales in modern taxonomy, 4th edn. Koeltz Scientific Books, Koenigstein Swofford DL (2004) PAUP*. Phylogenetic analysis using parsimony (* and other methods), Version 4.01.

Figure 2 MsrA/MsrB is induced upon overexpression of rpoE via transcriptional control. Protein analysis of the cytoplasmic and crude membrane fraction by SDS-PAGE (A) and corresponding transcriptional analysis of msrA/mrsB by RT-PCR (B) of the wt strain (H44/76) and H44/76 transformed with pNMB2144 before (-) and after induction (+). Molecular weight markers (in kDa) indicated on AZD5363 cost the left. Arrow indicates MsrA/MsrB. MsrA/MsrB is transcriptionally controlled

by σE To ascertain that msrA/msrB is under direct control of σE, transcript levels of msrA/msrB in diverse meningococcal genetic backgrounds were analyzed by RT-PCR using RNA isolated from cells grown in the absence and https://www.selleckchem.com/products/BafilomycinA1.html presence of IPTG and primers targeting msrA/msrB. When H44/76 wt or H44/76 + pNMB2144 cells were grown in the absence of IPTG, no detectable RT-PCR products were observed. In contrast, when H44/76 + pNMB2144 cells were grown in the presence of IPTG, an RT-PCR product with a size indicative of transcription of msrA/msrB was found

(Fig. 2b). The identity of the transcript was confirmed by sequencing of the RT-PCR product. These results strongly suggest that msrA/msrB is transcriptionally controlled by σE. NMB2145 inhibits transcription of the rpoE regulon One possible explanation for low σE activity in H44/76 wt cells under the growth conditions tested is that σE is kept in an inactive GSK872 manufacturer state through an interaction with an anti-σ factor, thereby preventing σE binding to core RNA polymerase, one of the ways to inhibit σ activity Thymidylate synthase found in σ-regulator circuits in other bacteria [43–47]. Interestingly, it was

recently reported that NMB2145 contains the ZAS motif Hisx3Cysx2Cys [48], characteristic for a subset of group IV σ anti-σ factors, usually encoded directly downstream of rpoE and cotranscribed [26]. Amino acid sequence comparison of orthologues of NMB2145 in genomes of three other meningococcal strains, two gonococcal strains and six commensal neisserial species (N. cinerea, N. flavescence, N. lactamica, N. mucosa, N. sicca and N. subflava) revealed that the region containing the ZAS motif, as well as the region around Cys4, are highly conserved in these neisserial orthologues of NMB2145. This in contrast with other much less well conserved parts, highlighting the importance of the conserved regions (Fig. 3). The relative positions of the Cys residue and the ZAS motif in NMB2145 (Cys4; His30, Cys34 and Cys37) correspond exactly with those of the Cys residue and the ZAS motif in RsrA (Cys11; His37, Cys41 and Cys44), the anti-σR factor of Streptomyces coelicolor, of which the Cys residues, but not His37, are essential for anti-σ activity of the protein [29] (Fig. 3). These observations suggest that NMB2145 codes for the meningococcal anti-σE factor.

The MST was created based on the categorical coefficient and a priority rule consisting of the highest number

of single-locus variants. Luminespib in vitro The polymorphism index of individual or combined VNTRs was calculated using the Hunter-Gaston discriminatory index (HGDI) [23]. Results Identification of VNTRs for MLVA typing Among the 130 TRs tested, only five were polymorphic with different allele sizes, making them useful for discriminating among types. The five VNTRs selected are distributed around the genome from nucleotide positions 181200 to 298794 in the M. hominis PG21 reference strain (Table 1). The PCR Selleckchem Combretastatin A4 products ranged in size from 153 to 290 bp in the M. hominis MK0683 chemical structure PG21 reference strain. All of the VNTRs were located in open reading frames (ORFs). Markers Mho-52, Mho-53 and Mho-116 were located in the rpoD gene encoding the RNA polymerase sigma factor RpoD, the pgsA gene encoding the CDP-diacylglycerol-glycerol-3-phosphate-3-phosphatidyl transferase and the oppA gene encoding the oligopeptide ABC transporter substrate-binding protein, respectively. The two other markers were located in ORFs encoding hypothetical proteins. The sizes of the unit repeats ranged from 3 bp to 42 bp.

Sequencing the PCR products of different sizes at each of the five loci from each of the 12 screening isolates confirmed the sizes and sequences of the individual VNTR loci. Table 1 Characteristics of the five VNTR markers Name Nucleotide positiona(bp) Locus (protein no. in the genome sequence) Repeat size (bp) Consensus sequence % identity between VNTRs HGDIb Mho-50 298627-298794 Hypothetical protein, predicted lipoprotein (MHO_2440) 42 TCAAGATTCTACAACCACAGGTGAAGATTCGACTGGACAATC 98 0.313 Mho-52 259317-259340 rpoD gene (MHO_2150) 3 GAT 82 0.203 Mho-53 246308-246325 pgsA gene (MHO_2070) 3 ATT 100 0.784 Mho-114 190335-190346 Hypothetical protein, predicted lipoprotein (MHO_1590) 6 TTGGCT Docetaxel clinical trial 100 0.336 Mho-116 181200-181202 oppA gene (MHO_1510) 3 GAA 100

0.020 aPosition (5’ end) on the M. hominis PG21 genome sequence. bHGDI, Hunter Gaston Diversity Index. The stability of the five polymorphic markers in five strains was examined after 10 serial passages in Hayflick modified broth medium supplemented with arginine. The analysis of the five strains resulted in identical MLVA profiles for all markers. The use of fluorescently labelled primers in two multiplex PCRs (Mho-50, Mho-52 and Mho-53 for PCR T1 and Mho-114 and Mho-116 for the PCR T2), and capillary electrophoresis facilitated the interpretation of the results, an improvement over the standard agarose gel electrophoresis. Using GeneMapper Software, all loci were clearly identified on electropherograms according to their size ranges and colours, and the amplicon sizes allowed the determination of repeat number.

41 1 <0.001 Field width + 5.87 1 0.015 Detrivores Ln(abundance) Age of field margin + 8.732 1 0.003 In all cases farm and year of sampling

were included in the random model. The model estimates are represented graphically in Figs. 2 and 3 NR not relevant Fig. 2 Mean number of taxonomic invertebrate groups (±SE) per age of field margin category. Estimated means and standard errors are based on the HGLM model with age as categorical variable. Trend is based on the same model with age as scale variable. Trend is significantly different from zero (Table 1B) Abundance of functional groups In total, 34,038 predator, learn more 11,305 herbivore and 10,720 detritivore individuals were caught with the pitfall traps. Predator abundance was significantly affected by the age find more category of the field margin (Table 1A); the abundance of predators

decreased with increasing age of the margin (Table 1B; Fig. 3). Herbivore abundance was significantly related to vegetation cover in summer, margin width and age category (Table 1A). A positive relationship with the age of the margin was found (Table 1B; Fig. 3). Detritivore abundance was not affected by age category (Table 1A), but a clear positive correlation between age of the margin and detritivore abundance was found (Table 1B; Fig. 3). Fig. 3 Mean number of individuals of predators, herbivores and detritivores (±SE) per age of field margin category. Estimated means and standard errors are based on the HGLM model of the Ln-transformed ��-Nicotinamide price Smoothened abundance data after correcting for other significant factors and with age as categorical variable. Trends are based on the same model with age as scale variable. All trends are significantly different from zero (Table 1B) Field margin variables Several site-specific variables showed significant relationships with the

age of field margins (Table 2): we found a decrease in the number of plant species (t = −5.585, P < 0.001) and in their evenness (t = −2.651, P < 0.001), the latter indicating that the vegetation is moving towards dominance by certain species. The vegetation cover in summer increased (R = 0.521, P < 0.001). No trends could be detected for nutrient richness, vegetation height in summer and winter, and vegetation cover in winter. Table 2 Significant relations between field margin age and site-specific variables; in a few cases, data for certain margins were lacking (number of replicates is given below each average) Variable (unit); transformation, test   Age 1 2 3 4 5 6 7 8 9 10 11 Sign (Back-transformed) averages (Replicates) Plant species (total number); Ln(x + 1), linear regression t = −5.585 − 18.683 15.653 9.137 17.014 11.375 9.781 8.582 5.989 6.937 10.917 11 P < 0.001 (27) (23) (4) (11) (16) (20) (12) (6) (2) (9) (1) Plant species evenness (E var); untransformed, linear regression t = −2.651 − 0.743 0.614 0.428 0.631 0.620 0.574 0.662 0.470 0.490 0.629 0.63 P < 0.

To counter the inherent minor variations

found between measurements of the MS spectra, the MS profiles in the reference library constructed here consist of the mean of 24 MS spectra. The fact that the identification of genetically highly related species appeared to be feasible demonstrates that even minor genetic differences are translated to specific proteomic differences. Conclusions Discrepancies between classical taxonomy selleck chemical and the genetic relatedness of species and biovars complicate the development of detection and identification assays. Despite these difficulties, the accurate identification of Brucella species was achieved with MALDI-TOF-MS by constructing a Brucella reference library based on genetic relationships according to MLVA data. We conclude that MALDI-TOF-MS can be developed into a fast and reliable identification method for

genetically highly related species when potential taxonomic and genetic inconsistencies are considered during the generation of the reference library. Acknowledgements We wish to thank K. Walravens for providing strains and D. van der Kleij for her comments and critical reading of the manuscript. This work was financially supported by the Dutch Ministry of Defense, grant number V1036. This work was part of the European Defence Agency (EDA) project B0060 involving biodefence institutions from Italy and The Netherlands. Electronic supplementary material Additional file 1: Table S1. Strains used during the study Temsirolimus datasheet with additional information. (XLS 98 KB) References 1. Brenner DJ, Krieg NR, Staley JT, Corbel MJ, Banai M: Bergey’s Manual of Systemic Bacteriology. In Volume 2 part C. 2nd edition. Edited by: Corbel ADAMTS5 MJ, Banai M. New York: Springer Science; 2005:370–386. 2. Franz DR, Protein Tyrosine Kinase inhibitor Jahrling PB, Friedlander AM, McClain DJ, Hoover DL, Bryne WR, Pavlin JA, Christopher GW, Eitzen EM Jr: Clinical recognition and management of patients exposed to biological warfare agents. JAMA 1997, 278:399–411.PubMedCrossRef 3. Yagupsky P, Baron EJ: Laboratory exposures to brucellae and implications for bioterrorism. Emerg Infect Dis 2005, 11:1180–1185.PubMedCrossRef 4. Yingst SL, Huzella LM, Chuvala L,

Wolcott M: A rhesus macaque ( Macaca mulatta ) model of aerosol-exposure brucellosis ( Brucella suis ): pathology and diagnostic implications. J Med Microbiol 2010, 59:724–730.PubMedCrossRef 5. Cloeckaert A, Verger JM, Grayon M, Paquet JY, Garin-Bastuji B, Foster G, Godfroid J: Classification of Brucella spp. isolated from marine mammals by DNA polymorphism at the omp locus. Microbes Infect 2001, 3:729–738.PubMedCrossRef 6. Foster G, Osterman BS, Godfroid J, Jacques I, Cloeckaert A: Brucella cet sp. nov. and Brucella pinnipedialis sp. nov. for Brucella strains with cetaceans and seals as their preferred hosts. Int J Syst Evol Microbiol 2007, 57:2688–2693.PubMedCrossRef 7. Jahans KL, Foster G, Broughton ES: The characterisation of Brucella strains isolated from marine mammals.

In Fire blight: the disease and its causative agent, Erwinia amylovora. Oxon, UK: CABI Publishing; 2000.CrossRef 4. Bonn WG, Van der Zwet T: Distribution and economic importance of fire blight. In Fire blight: the disease and its causative agent,

Erwinia amylovora. Oxon, UK: CABI Publishing; 2000:37–53.CrossRef 5. McManus PS, Stockwell VO, Sundin GW, Jones AL: Antibiotic use in plant agriculture. Annu Rev Phytopathol 2002, 40:443–465.PubMedCrossRef 6. Nikaido H: Multidrug efflux pumps of gram-negative bacteria. J Bacteriol 1996, 178:5853–5859.PubMedCentralPubMed 7. Walsh C: Molecular mechanisms that confer antibacterial drug resistance. Nature 2000, 406:775–781.PubMedCrossRef 8. Piddock LJ: Multidrug-resistance efflux pumps – not just for resistance. Nat Rev Microbiol 2006, 4:629–636.PubMedCrossRef 9. Pos K: Trinity buy LCZ696 selleck chemical revealed: Stoichiometric complex assembly of a bacterial multidrug efflux pump. Proc Natl Acad Sci U S A 2009, 106:6893–6894.PubMedCentralPubMedCrossRef 10. Nakamura H: Gene-controlled resistance to acriflavine and other basic dyes in Escherichia coli . J Bacteriol 1965, 90:8–14.PubMedCentralPubMed

11. Nikaido H: Antibiotic resistance caused by gram-negative multidrug efflux pumps. Clin Infect Dis 1998,27(Suppl 1):S32-S41.PubMedCrossRef 12. Ma D, Cook DN, Alberti M, Pon NG, Nikaido H, Hearst JE: Molecular cloning and characterization of acrA and acrE genes of Escherichia coli . J Bacteriol 1993, 175:6299–6313.PubMedCentralPubMed 13. Rosenberg EY, Ma D, Nikaido H: AcrD of Escherichia coli is an aminoglycoside efflux pump. J Bacteriol 2000, 182:1754–1756.PubMedCentralPubMedCrossRef 14. Elkins CA, Nikaido H: Substrate specificity of the RND-type multidrug efflux pumps AcrB and AcrD of Escherichia coli is determined predominantly by two large periplasmic loops. J

Bacteriol 2002, 184:6490–6498.PubMedCentralPubMedCrossRef 15. Poole K, Krebes K, McNally C, Neshat S: Multiple antibiotic resistance in Pseudomonas aeruginosa : evidence for involvement of an efflux operon. J Bacteriol 1993, 175:7363–7372.PubMedCentralPubMed 16. Burse A, Weingart H, Ullrich MS: The phytoalexin-inducible multidrug efflux pump AcrAB contributes to virulence in the fire eFT508 blight pathogen, Erwinia amylovora . Mol Plant-Microbe Interact 2004, 17:43–54.PubMedCrossRef 17. Org 27569 Al-Karablieh N, Weingart H, Ullrich MS: Genetic exchange of multidrug efflux pumps among two enterobacterial species with distinctive ecological niches. Int J Mol Sci 2009, 10:629–645.PubMedCentralPubMedCrossRef 18. Grkovic S, Brown MH, Skurray RA: Regulation of bacterial drug export systems. Microbiol Mol Biol Rev 2002, 66:671–701.PubMedCentralPubMedCrossRef 19. Nishino K, Honda T, Yamaguchi A: Genome-wide analyses of Escherichia coli gene expression responsive to the BaeSR two-component regulatory system. J Bacteriol 2005, 187:1763–1772.PubMedCentralPubMedCrossRef 20.