Authors’ contributions C.L. and S.D. designed the experimental plan. C.L. performed most of the experiments; G.J. and W.K. did strain collection and isolation, respectively; W.H. did gap gene sequencing analysis; Y.Z. performed PFGE data analysis; C.R. participated in strain identification Y.L. AZD0156 concentration performed drug resistance learn more phenotype detection; C.L. and S.D. analyzed the data and wrote the manuscript; all authors have reviewed the manuscript.”
“Background Human pathogens often evolve from animal reservoirs, and changes in virulence sometimes accompany acquisition of the ability to infect humans [1]. Examples include smallpox virus,

HIV, enterohemorrhagic E. coli, and Bordetella pertussis. Understanding how these events occur requires the ability to reconstruct evolutionary history, and this can be

facilitated by the identification of evolutionary intermediates. An experimentally tractable opportunity to study human adaptation is provided by Bordetella species. The Bordetella genus currently includes nine closely related species, several of which colonize respiratory epithelial surfaces in mammals. B. pertussis, the etiological agent of pertussis (whooping cough) is exclusively adapted to humans; B. parapertussis refers to two groups, one infects only humans and the other infects CA3 sheep [2, 3]; and B. bronchiseptica establishes both asymptomatic and symptomatic infections in a broad range of mammalian hosts, which sometimes include humans [4–7]. Numerous studies have implicated B. bronchiseptica as the closest common ancestor of human-adapted bordetellae, with B. pertussis and B. parapertussis hu , evolving independently from different B. bronchiseptica

lineages [8–10]. The genomes of these 3 species differ considerably in size and B. pertussis and B. parapertussis have undergone ADAMTS5 genome decay, presumably as a consequence of niche restriction [6]. Most mammalian bordetellae express a common set of virulence factors which include putative adhesins such as filamentous hemagglutinin (FHA), fimbriae, and pertactin, and toxins such as a bifunctional adenylate cyclase/hemolysin, dermonecrotic toxin, and tracheal cytotoxin. B. pertussis additionally produces pertussis toxin [7]. Of particular significance here is the bsc type III secretion system (T3SS) locus which encodes components of the secretion machinery, associated chaperones, and regulatory factors. Remarkably, only a single T3SS effector, BteA, has been identified to date [11–13]. BteA is an unusually potent cytotoxin capable of inducing rapid, nonapoptotic death in a diverse array of cell types [14–16]. T3SS and bteAloci are highly conserved in B. pertussis B. parapertussis, and B. bronchiseptica[14, 15]. A seminal phylogenetic analysis using multilocus sequence typing (MLST) of 132 Bordetella stains with diverse host associations led to the description of a new B.

As we have shown here that the short fimbria mutant MPG67 developed greater biofilm accumulation than the wild type, it is likely that ClpXP has numerous effects on cell surface molecules important in biofilm development. The long/short fimbriae mutant MPG4167 and RgpA/B mutant KDP133 developed biofilms with significantly large amounts of bacterial cells. In addition, the exopolysaccharide/cell ratio

was significantly smaller than the other strains, and the biofilms of these strains were shown to be fragile (Figures 5C and 6). Rgp is an enzyme that processes precursor proteins of bacterial surface components such as fimbriae [22, 23], therefore, Rgp-null mutants exhibit defective surface protein presentation. Thus

not only MPG4167 but also KDP133 do not have intact fimbrial protein on the cell surface, which might be related Rabusertib to imperfect anchoring of selleck chemicals llc exopolysaccharide on the bacterial surfaces. The gingipains null mutant KDP136 did not show the same tendency in spite of the lack of both types of fimbriae, suggesting the presence of Kgp was related to the unusual exopolysaccharide accumulation. In contrast, long fimbriae mutant KDP150 formed a tough and cohesive biofilm, and its exopolysaccharide/cell ratio was significantly higher than the other strains. Together, these findings suggest that the exopolysaccharide/cell ratio seems to be related to the physical strength of P. gingivalis biofilms. The specific role of Kgp may involve regulation of biofilm formation by the dispersion, de-concentration, GW3965 order and/or detachment of microcolonies. Rgp also seemed to coordinate the integrity of the biofilm in the developing phase as well as maturation phase. There are several reports which suggest that the present morphological changes in proteinase mutants N-acetylglucosamine-1-phosphate transferase were possibly due to loss of proteolytic activities. In Staphylococcus aureus, increased levels of serine proteases were detected in detaching biofilm effluents, and a serine protease inhibitor suppressed the biofilm detachment

[34]. In the same report, a double mutant in a metalloprotease and serine proteases, which displayed minimal extracellular protease activity, showed significantly enhanced biofilm formation and a strongly attenuated detachment phenotype. In Streptococcus pneumoniae, trypsin or proteinase K was shown to inhibit biofilm development, and incubation of mature biofilms with proteinase K drastically diminished the number of biofilm-associated sessile cells [35]. Since our data also showed that the mutation in gingipain genes resulted in enhanced biofilm formation as well as a strongly attenuated detachment phenotype, this suggests that proteinase domains of Kgp and Rgp are significantly involved in biofilm regulation [5].

Each isolate was tested in duplicate. No Template Controls (NTCs) and previously characterized positive controls were used for each primer set as well. Mutation detection in the gyrA and pbp5 genes All ciprofloxacin- and ampicillin-resistant and intermediate-resistant isolates were screened

for gene mutations. The gyrA and pbp5 genes were amplified and sequenced. Primers used were: 5′CGGGATGAACGAATTGGGTGTGA3′and 5′ AATTTTACTCATACGTGCTTCGG 3′ (gyrA forward and reverse respectively); and 5′ CGGGATCTCACAAGAAGAT 3′and 5′ TTATTGATAATTTTGGTT 3′ (pbp5 forward and reverse respectively) [34–36]. Sequencing reactions were prepared as for the SNP H 89 supplier validation step described above. Sequence data was Selleckchem Doramapimod analysed using Chromas (version 1.43, Technelysium, Tewantin, Australia) and Vector NTI (version 11, Invitrogen, Australia) software programs. Results and Discussion The poor microbiological quality of recreational waters is a global issue [37, 38]. There is a great need to rapidly and KPT-330 mouse accurately determine human faecal contamination of recreational

waters. We applied a SNP genotyping method to water samples collected from the Coomera River, South East Queensland, Australia, to determine the distribution and diversity of E. faecalis and E. faecium strains and establish the antibiotic profiles associated with different SNP profiles. Total enterococccal counts in the Coomera River, over a two year period Enumeration of enterococcal strains was performed at each of the six sampling sites along the Coomera River, and these counts were compared to the single-sample advisory limit specified by the US Environmental Protection Agency (USEPA) and the Australian NHMRC Guidelines

for water quality assessment. Phospholipase D1 Previous studies have found that the concentration of faecal indicator bacteria in surface waters is influenced by storm water runoff and can increase dramatically during rainfall events in comparison to baseline conditions [39–42]. Similarly, we found an increase in the number of enterococci at three of the sampling sites after rainfall events (August 2008 and March 2009). There was a substantial increase in enterococcal colony counts at Jabiru Island (C4), Paradise Point (C5) and Coombabah (C6) after rainfall events. These findings were confirmed by the Mann-Whitney test which showed that enterococcal counts after rainfall events differ significantly between the different locations; C4-C5 (p = 0.004) compared to C1-C3 (p = 0.029), (additional file 1). These counts were well above the USEPA recommended level (61 cfu/100 ml). According to the Australian NHMRC Guidelines these locations are categorised into the microbial water quality assessment category B (41-200 cfu/100 ml), except for Jabiru Island (March 2009), which was category C (201-500 cfu/100 ml).

Several antagonists ABT-888 order of Fusarium oxysporum, Heterobasidion abietinum and H. annosum were detected (Figure 1a). Instantly recognizable was the strong suppression of Heterobasidion strains by isolates AcM11 and AcM34, associated with significant inhibition of F. oxysporum. In general, the two Heterobasidion strains responded somewhat differentially to bacterial treatments. While suppression of H. abietinum was marked with isolates

AcM37 (42% growth rate), AcM12 (47%), and AcM08 (64%), co-cultures of H. annosum with the same bacteria led to less inhibition (54%, 75% and 85%, respectively, growth rate compared to the pure culture mycelium). In co-cultures with AcM01 and AcM35, in contrast, mycelial growth of H. abietinum was less inhibited than that of H. annosum. Growth of H. abietinum was promoted THZ1 chemical structure by AcM25 while none of the other plant pathogenic

fungi showed a positive response to the bacteria. Figure 1 Influence of streptomycetes on the growth of plant pathogenic and ectomycorrhizal fungi. The plant pathogenic fungi (a) Fusarium oxysporum, Heterobasidion abietinum and Heterobasidion annosum were cultured for one week, and the mycorrhizal fungi (b) Amanita muscaria, Hebeloma cylindrosporum and Laccaria bicolor, were cultured for eight weeks with Norway spruce ectomycorrhiza associated streptomycete isolates. The extension of fungal mycelium was measured, and selleck related to the treatment without bacteria (None = value 100). Mean and standard

error of each experiment with at least 5 replicates are indicated. Signficant difference in mycelial growth in comparison to control without bacterial inoculation, determined by one way analysis of variance (p < 0.05), is indicated by asterisks. Qualitative differences were observed between the responses of the tested mycorrhizal fungi towards the streptomycetes (Figure 1b). Laccaria bicolor 17-DMAG (Alvespimycin) HCl was promoted by four and inhibited by seven bacteria, Amanita muscaria and Piloderma croceum were inhibited by nine and three strains, respectively, but not promoted. Hebeloma cylindrosporum was, in general, inhibited. The bacterial strains AcM1, AcM8, AcM11, AcM34, AcM35 and AcM37 inhibited all symbiotic fungi. Strain specific patterns of inhibition in Streptomyces-Streptomyces interaction bioassays In order to assess the interactions between streptomycetes and other bacteria in more detail and to approach the chemical diversity of the streptomycetes, five Streptomyces strains were selected for further studies according to their differential impact on fungal growth. These were AcM9, AcM11, AcM20, AcM29 and AcM30. First, co-culture bioassays were used to evaluate how the five Streptomyces strains affect each other (Figure 2a, b).